made-up sequencing oor Frans

made-up sequencing

Vertalings in die woordeboek Engels - Frans

séquençage à façon

Termium

Geskatte vertalings

Vertoon algoritmies gegenereerde vertalings

voorbeelde

wedstryd
woorde
Advanced filtering
Voorbeelde moet herlaai word.
Said scenario comprises groups of data made up of sequence identifiers an at least one time display window.
Le cas échéant le groupement d'employeurs et les données de tous les employeurs participants conformément à l'acte d'adhésionpatents-wipo patents-wipo
Quite simply, they couldn’t stop seeing their world as being made up of sequences of Tetris blocks.
Des inquiétudes se sont formées au fil du temps à propos de l'exploitation d'économies d'échelle par des intervenants urbains, principalement Sydney et Melbourne, dans les milieux ruraux.Literature Literature
The resulting piece, a celebration of brute energy, is made up of sequences whose intensity resides in the concentration on detail rather than in broad gestures.
Exact, votre amie, JoyceCommon crawl Common crawl
Proteins made up of long chains of peptides, in turn made up of sequences of amino acids, mediate most functions from the cellular level all the way up to the level of the organism.
Oui bien surcordis cordis
Thus, every enzyme is made up of a sequence of amino acids.
Précautions particulières d emploiLiterature Literature
The UWB waveform is made up of a sequence of shaped wavelets.
Farines, semoule et poudres de légumes à cosse secspatents-wipo patents-wipo
The first is made up of a sequence of numbers and letters.
Les doses médianes létales étaient d environ # mg/kg (souris) et # mg/kg (ratsLiterature Literature
The strategy is made up of a sequence of three themes:
AMERIMAGE QUEBEC INC.Giga-fren Giga-fren
The data stream is made up of a sequence of packets of media data, and each packet is identified by a sequence identifier.
Tu peux me faire une faveur quand même?Tu peux lui donner ça?patents-wipo patents-wipo
The 2D video is segmented to generate a temporally consistent segmented 2D video which is made up of a sequence of segmented frames.
J' avais tortpatents-wipo patents-wipo
He would have sequences made up.
Afin d'aider à établir un consensus relativement aux éléments qui devraient être suivis, et à la manière de le faire, on propose un modèle conceptuel de mesure et de gestion des résultats.OpenSubtitles2018.v3 OpenSubtitles2018.v3
The calling song consists of a two-part sequence made up of a succession of pulses.
Ce serait bien si tu t' occupais plutôt de tes fessesGiga-fren Giga-fren
A segment of the DNA molecule, made up of linear sequences of four molecules (bases), that carries the structural information for the assembly of a protein.
Tout système de baraquage installé sur un véhicule doit être tel que le véhicule ne puisse rouler à une vitesse supérieure à # km/h lorsqu’il est plus bas que la hauteur normale de marcheGiga-fren Giga-fren
In one embodiment, a method includes receiving, at a local node of a network, a sequenced data packet of a flow made up of multiple sequenced data packets from a source node directed toward a destination node.
Est- ce la résidence des Simmons?patents-wipo patents-wipo
On the other hand, a lower frequency of A-T rich (DAPI stained) heterochromatin was found in pentaploid species than in diploid ones, indicating that heterochromatin in pentaploid species is made up of sequences with base compositions different from those of diploid species.
Erbitux peut être administré à l aide d un goutte-à-goutte, d une pompe à perfusion ou d une seringue électriqueGiga-fren Giga-fren
The present invention relates to an aptamer which includes a nucleic acid including or made up of: the sequence GGAACGCAAGAACUGAGGCCAUGAGGCGCCUUCCCUUGCUCA GGACGC (SEQ ID NO: 1), or the sequence AGCUAGGCCGCAAGGUGCCUCAACGCCAUCUGAGUGCCGACC CGAUCGC (SEQ ID NO: 2), or a sequence including or made up of at least 25 consecutive nucleotides of a sequence that is at least 80% identical to SEQ ID NO: 1 or to SEQ ID NO: 2, with the condition that a nucleic acid made up of said sequence is bonded to annexin 2.
Selon le requérant devant le Conseil d'Etat, le mémoire du Conseil des Ministres est irrecevable parce qu'il ne fait pas expressément apparaître que le Conseil des Ministres a décidé, premièrement, d'intervenir dans la présente affaire et, deuxièmement, de désigner des avocatspatents-wipo patents-wipo
Read in sequence, they made up a riveting saga of frustrations, humiliations and atrocities.
Merci, gente dameLiterature Literature
But what did strike him as odd was how the numeric sequences were made up of four numbers.
Chez ces patientsLiterature Literature
Each of the sequences is made up of three types of symbols, constants, delimiters and variables.
Règlement (CEE) no #/# du # juin # fixant des normes de qualité pour les choux pommés, les choux de Bruxelles, les céleris à côtes, les épinards et les prunespatents-wipo patents-wipo
The Mont Ham Massif (part of the Thetford Mines ophiolite, south Quebec) represents a magmatic sequence made up of tholeiitic and boninitic derived products.
L'OPIC décline toute responsabilité quant à l'exactitude, à l'actualité et à la fiabilité de l'information fournie par de telles sources.Giga-fren Giga-fren
The dentition of the mandible that was reconstructed (from two left fragments) made up the complete sequence of the original teeth of mammals: with three incisors, one canine, four premolars and three molars.
Fanny, la question n' est pasWikiMatrix WikiMatrix
DNA molecules are made up of a linear sequence of compounds called nucleotides, and form a long, continuous strand inside a structure called a chromosome.
Elle a été tuée un jour avant HalloweenGiga-fren Giga-fren
These special proteins contain a specialized retention signal made up of a specific sequence of amino acids that enables them to be retained by the organelle.
De plus amples renseignements peuvent être obtenus par téléphone auprès de M. E.J. Hoppel, au numéro suivantWikiMatrix WikiMatrix
Each of the data sequences and the query sequence is made up of three types of symbols, constants, delimiters, and variables.
Le sujet est trés clair et il est maintenant clospatents-wipo patents-wipo
A video ad sequence is made up of a series of video ads that you’d like to show to a person.
L'inspection de l'enseignement secondaire artistique à horaire réduit évalue annuellement la mise en application du présentdécret et s'assure que la réalisation pédagogique des activités de formation en cours de carrièresupport.google support.google
279 sinne gevind in 37 ms. Hulle kom uit baie bronne en word nie nagegaan nie.